?> MycorWeb

Tuber melanosporum DB

You are here: Genome resources Tuber melanosporum DB EST & Gene Sequences View EST sequence

Tuber melanosporum EST database

Sequence Name: SY0AAC17YD06RM1
Length(NT) : 408
Member of Contig: Contig3928


Sequence:

>SY0AAC17YD06RM1
CTATGAAAATACTTTTTCTGTTTTTGTTCTATTTCTTAAACTTTCAACCA
ACCTAACTTACAAGGTATCATCTCACATCGGAAAAAAAAAATCAAGCGCC
AATAGCCTTGGAAATCGCCTCCATGGAAAGACTTTTGGGCCTCTCGATCG
GCAAGCCGAGAGCTCGATCCCAAATCAGCTGTGCCAGGGGACCCAAGCCT
CTCGACACGCCGAAAGTAACGGTGTAGTACAGGTCTTGGTTGATTCCATA
ATGATGAAACAAAACGCCGGAAGCAAAATCCACGTTCGGATGCGGGTTCT
TGGTCTTCCCGTGCTCCGTCAAAACCCTTGGCGCGATCTCGCTGTTCTTC
TTGACGAGTTTAAATACGGCTCCTTCCGCCACTTCGGGACGGGACTCGGC
AAAACCCA

NCBI BlastX