?> MycorWeb

Tuber melanosporum DB

You are here: Genome resources Tuber melanosporum DB EST & Gene Sequences View EST sequence

Tuber melanosporum EST database

Sequence Name: SY0AAC15YA24FM1
Length(NT) : 509
Member of Contig: Contig3740


Sequence:

>SY0AAC15YA24FM1
TTGGACCATATCGTCAACTCCACCTTCAACTAACTCTACCCAGACCACTA
CGCTACTTAGTGTTCAGCTCTCGACTGCGTCTAGTGTACCGATACCGTGC
AGTTTTTTTTTCTTTTTTTCTTTGTTGTTTTTTCCTTCTTTTCTTTTCTT
TCGCTCGCTTCTCCCTTTGCGGGACTGACAAGCTTTTCTATTTCGCCCTC
TGGCGCCCGCGGGCTAGCCCCGAATCCCGTGGTCTAGGGGTCTACGAGCG
AGAGACCATGGATCTTACCAATTCTTATATTTTTAGTAACTCGACGCTGG
CCGAAATTCTAGATGACCTTTGTGTGAGATTCATCATCAATCTACCAGAG
GAGGAGCTGAGTTCGATTGAGCGAATATGTTTTCAAATCGAGGAGGCGCA
GTGGTATTTCGAGGATTTCATCCGAGAAACGAATCCCATGCTGCCTACAC
TTCCGCTCCGTACTTTTCTTAATAAGATCTTTGCTATCTGTCCGCTACCT
ATCTTGAAG

NCBI BlastX