?> MycorWeb

Tuber melanosporum DB

You are here: Genome resources Tuber melanosporum DB EST & Gene Sequences View EST sequence

Tuber melanosporum EST database

Sequence Name: SY0AAC14YM17FM1
Length(NT) : 669
Member of Contig: Contig179


Sequence:

>SY0AAC14YM17FM1
TTGGAAACACTAGAAGCACAGCAACCCCAATCCCCTTCACCCACACAACC
GCCTCCACAAAATTCCCGAAAACGCGCTGCATCCGGTCCTGAGAACGATG
CCCCTGTTCCTCCAGCAACGCCGATGGCCATGGCTACGACCACGGTTGTA
GGCCCTCACCCCTTGCGGACAAATTCCCCTGCTGTGGAGAAGAAGTTGGA
GTGCTTGCCCACTGGAAAGTCGAAAATGGCAGCCAAACCGACTGCCGCCA
AACACAAGTTCTCGTCAATAGACGGTCCTCAAATTTACTACGATGGTGAG
GCTCAACAGACATTTTACGATTGCTGGACCACGCTTAATTCTAAGCGGGG
ATTGCTGAGGAAGGAGATGATGACTATTAGGAGGAAACGGGTCATGACAT
TACCGACGCATAACTACGGTTATGATGACGACTCCGAGGAGGAGGGATCT
GATAAGGAGTCTGACCAGGGGCCTAAAGAGACCGAGGAGGAAAGGTTGAA
GAGGGAGGAGGAGGAGCGGAAGAAGGCTGAGGAGGAGCGATTGAAAGCAG
AGCGGGAAAAAAAGGCGGCGGAGGTTCTGGAGTACATCGACTCGTGTCTG
GATAAGGCGTCGAAAGGGTGTGAGAATGCTGCCTTCTTGTGGTTGAAAGG
GGATATCTGCGCAGGTCAC

NCBI BlastX