?> MycorWeb

Tuber melanosporum DB

You are here: Genome resources Tuber melanosporum DB EST & Gene Sequences View EST sequence

Tuber melanosporum EST database

Sequence Name: SY0AAC12YD19FM1
Length(NT) : 621
Member of Contig: SY0AAC12YD19FM1

BlastX hits against the NCBI non-redundant database:
DefinitionScoreE_valueAccession Number
hypothetical protein DR_0254 [Deinococcus radiodurans R1]1312e-15 gb|AAF09840.1|AE001886_6

Sequence:

>SY0AAC12YD19FM1
TTGGACTGTTATGGCTAGGGGGTCATTGCGACTTACCAAACCATTGCAAA
CTCCGAATACCGATGAGTGCGAGCTTGGGAGACAGACGTCGGGTGCTAAC
GTCCGGCGTCAAGAGGGAAACAACCCAGACCGCCAGCTAAGGTCCCAAAG
ATTGGCTAAGTGGAAAACGAAGTGGGAAGGCTAAAACAGTCAGGATGTTG
GCTTAGAAGCAGCCATCATTTAAAGAAAGCGTAATAGCTCACTGATCGAG
TCGTCCTGCGCGGAAGATGTAACGGGGCTAAGCCAGTCACCGAAGCTGCG
GATATTGTTCTGTGATTTATCACAGATATATATGGTAGGAGAGCGTTCTG
TAAGCCTGCGAAGGTGTCTTGTAAAGGATGCTGGAGGTATCAGAAGTGCG
AATGCTGACATGAGTAGCGATAATGGGGGTGAAAAGCCTCCACGCCGTAA
GCCCAAGGTTTCCTGTTCAACGTTCATCGGAGCAGGGTGAGTCGGCCCCT
AAGGCGAGGCAGAGATGCGTAGCTGATGGGAAGCAGGTTAATATTCCTGC
ACCGTCGTATGATGCGATGGGGGGACGGATCGCGGAAGGTTGTCTGACTG
TTGGAATAGTCAGTTTCTGTC

NCBI BlastX