?> MycorWeb

Tuber melanosporum DB

You are here: Genome resources Tuber melanosporum DB EST & Gene Sequences View EST sequence

Tuber melanosporum EST database

Sequence Name: SY0AAC11YN22FM1
Length(NT) : 664
Member of Contig: SY0AAC11YN22FM1

BlastX hits against the NCBI non-redundant database:
DefinitionScoreE_valueAccession Number
hypothetical protein FG01614.1 [Gibberella zeae PH-1]1592e-09 ref|XP_381790.1|

Sequence:

>SY0AAC11YN22FM1
TGTACAAAAAGTTGGGTTTCAATACTTGTACATTAATGGGTACCCTGTGC
CTATGGGGACGACCTTGCTGCATGAGGAGATCAATCGGTTATTTGCTGCT
TCCTCTTTTGGCGTGGTAGAGGAGGACGATGGAACAAAAAGGCTGAGGGG
TAATCCGAAGAAGGGTGCCGATAGGTGGGCCATGTTTGTACTGCGTGTCG
AATGTCAGCGACGAGAAGTGGATGTCATAGGTGGTGAAGGTGGGACAAAA
GGGAAAGCCGGGCTGGAGGGTGATAATCTTAGTGCCACAATCGGGCTTCT
GCAAAGGCTCATTCATGAATTCCTGAGAACTCATTATTTCCGCTCCACCC
TAGCGACGGCTACGAAGCCCCAAAGGGGCGAAGGGACCACAATTCGTGCA
TCCCCCCAATCGGCATTAGATCTTCTGGGCGAGTCCCGGCCAAGAACACC
ACTGGGTGTCCTCCGCAGAAATACCAATACAGCATCGTCTCAAACAAAAG
ACACCGGAAAATTGACAAAAAGTAGAGACCTCGGAGTATTGGCAAGCTGG
AGCAGAGTCAAATCCGCCCGAGCCGATCCAAGGGAAGAAGAAGGCAGACA
GGGTCCGGGATTTTCAAAAGCGCTTACCTTCTCACCCGCACCCCTCCCTG
CTGGATCTCGCCTG

NCBI BlastX