?> MycorWeb

Tuber melanosporum DB

You are here: Genome resources Tuber melanosporum DB EST & Gene Sequences View EST sequence

Tuber melanosporum EST database

Sequence Name: SY0AAC10YB20FM1
Length(NT) : 357
Member of Contig: Contig5908


Sequence:

>SY0AAC10YB20FM1
TTGGTTTTCAGCAACGAAAACTTGTCCTAATCCCCGTATCAATCGATAAG
ATGGGCATTTGGCAATCAAGAACTGGCGAGGACTATTCTTCACCGCAAGG
CGGCGGTTCTACTACCGGGGCCAATATCGATGTTAGAGGCGACAATAGCG
GCAACTCCGGCTCTCATAATAGGTTCTCCTCCCATAACATCACCACCATC
TTCAATGTCTGGGGCACAAACTCCTCCCAGAAACATGACGAAATTTTACA
ATGCCTATACACATCCAGCTACCCGTCGCACCGAGCCCGGGTTCGTGAGC
CGACCGAGGGAACGTGCACTTGGGTTACGGAACATCCGAAGTACAAGGAC
TGGTCGG

NCBI BlastX