?> MycorWeb

Tuber melanosporum DB

You are here: Genome resources Tuber melanosporum DB EST & Gene Sequences View EST sequence

Tuber melanosporum EST database

Sequence Name: SY0AAB9YF17FM1
Length(NT) : 681
Member of Contig: SY0AAB9YF17FM1

BlastX hits against the NCBI non-redundant database:
DefinitionScoreE_valueAccession Number
hypothetical protein SS1G_07739 [Sclerotinia sclerotiorum 1980]3591e-32 ref|XP_001591114.1|

Sequence:

>SY0AAB9YF17FM1
TTGGCCACCAACAAAGCACCTTCGAAATTTCTCGAAAATGGCAGCAAAGC
CCAAAGCTAACCTTCATGCCCTCCCAGAACTGAAGAACACATCCGATGAT
TCTATAGCTCTCTATCTAAAATCAAAAGGCTGGAAGCAAAACCACACTCT
CACGGATGTCCGCCTTGTCTTGGGCTTCTCTGCCGTCATAATCGCCGGAG
GCACCTTCTATTATGATTACACTCTCGGCTTCGATAAGACAAAGGTCATG
ACTTTATATGCTGTGATCGCCTATTTTGTCGCCAACATAATTCTCACATG
GTGGATATGGGGTATGGAAAGCGGTAAGGTTTATGTGGGTTCAAAAGACG
GCGTCACTATCACTATATCGTCACACACCGAGAAGCATTCACCAATCTAC
CATCTCAAAATTGTTTCTCGATCGCCGGGACAGAGGCCTACTACGACCGA
AGTAGAGAGTCCCTTCACCAGCTGGTTTGATACACAGGGATTCCTTGTGG
AGAAGCCATTCATGACCTTTATATCAAATTCCATCCCCTCGATGGCAGCA
ACAACCCCCGAGGGACAGCACCTAAAATCCAAACCGAAACCGAAAAGCAC
GAAGAAGGCTTAAATTGATCGAATCGGCTGTGTCGAGACTGAAAATAAAA
ATGGGTCTACAGATTCCATCACTACCGTGAA

NCBI BlastX