?> MycorWeb

Tuber melanosporum DB

You are here: Genome resources Tuber melanosporum DB EST & Gene Sequences View EST sequence

Tuber melanosporum EST database

Sequence Name: SY0AAB8YM21FM1
Length(NT) : 704
Member of Contig: SY0AAB8YM21FM1

BlastX hits against the NCBI non-redundant database:
DefinitionScoreE_valueAccession Number
beta tubulin [Sclerotinia sclerotiorum 1980]9147e-97 ref|XP_001594844.1|

Sequence:

>SY0AAB8YM21FM1
TTGGTCTATCTATAAATCACAATTTTACGTTTATTCACCCGATTTACGAA
TCAATTACACCTTCCTCTATAGTCGTAAGTTTACCTTGTCTACCCCTCCG
GGAGACGCGTTTTGGAATCAGAATGCGCGAAATCGTTCACTTGCAAACTG
GTCAGTGCGGTAACCAGATTGGTGCCGCTTTCTGGCAAACAATCAGTGGA
GAACATGGACTTGATGGGTCGGGTGTCTACAACGGAACGAGTGACCTGCA
GCTCGAGCGTATGAATGTCTACTTCAATGAGGTTGGTGCTTCCGGCAACA
AATACGTTCCCCGTGCTGTGTTGGTCGACTTGGAACCGGGTACCATGGAC
GCTGTTCGATCCGGTCCCTTCGGAAACCTCTTCAGGCCGGATAACTTCGT
CTTTGGACAATCCGGTGCTGGTAACAACTGGGCCAAGGGCCATTATACCG
AGGGTGCTGAACTTGTCGACCAGGTGTTGGATGTCGTTCGTCGTGAGGCC
GAAGGCTGCGACTGTCTGCAAGGTTTCCAGATTACTCACTCGCTTGGTGG
TGGTACTGGCGCTGGTATGGGAACGCTCTTGATCTCCAAGATCCGTGAAG
AGTTCCCCGACAGAATGATGGCCACTTTCTCCGTTGTTCCTTCACCTAAG
GTCTCAGACACCGTTGTTGAACCATACAACGCCACCTTATCGGTACACCA
GCTT

NCBI BlastX