?> MycorWeb

Tuber melanosporum DB

You are here: Genome resources Tuber melanosporum DB EST & Gene Sequences View EST sequence

Tuber melanosporum EST database

Sequence Name: SY0AAB8YC13FM1
Length(NT) : 645
Member of Contig: SY0AAB8YC13FM1

BlastX hits against the NCBI non-redundant database:
DefinitionScoreE_valueAccession Number
hypothetical protein SS1G_07910 [Sclerotinia sclerotiorum 1980]3771e-34 ref|XP_001591284.1|

Sequence:

>SY0AAB8YC13FM1
TTGGAGTTGATGAGACCGCTCCTCTCCCGAATAATACCACTCCTCCTCCT
CTCTATCGTAATCCTAAGCATCCTCTTCGCTACCGTCTACCTCCCACAAG
TTGCGCTACTCACTCTTTTCCACGGACCCCTAGCATGGATAAATGCAGCG
TTCATGGCCCTAACCGAAGCCGCGACGCTGATAACCTTTGTCGCAGAGAA
CTTCATGACAGAAGGCCAGATCGTGGATACCTTTGACGCTGTGCTTATAC
ACGCGGCTTAGAAGTCTAACGATGCAGAGTTTAGAGAGCGTATTTATGCC
CTTGTACACACTGCTAGGGATATTCATCTCGAGAGGGAGGGGGTCATAGC
GAAGTTGGGGGAGCATAGGAAGAGTCCTTATCTGAGGTTTTCGTGTAGGC
TTACGATGGAATTTATTTGCGAGCTCCCGTTGAATTTCATTCCGTTGGTT
GGAACTCCGCTGTTTTTGATGTTACAGGGCTACCATCTCGGCCCACTATC
GCATTACCGATACATTCAACTCAACGACTTACATAAAAAAGAAAAGAAGA
AATTTATTGACCTTAATAGGTGGAGATACTGGCTATTTGGGCTGCCGCAC
GTCGGTCTGCAAGTTGTACCTGTATTAAGTATCCTATTCCTGTTC

NCBI BlastX