?> MycorWeb

Tuber melanosporum DB

You are here: Genome resources Tuber melanosporum DB EST & Gene Sequences View EST sequence

Tuber melanosporum EST database

Sequence Name: SY0AAB8YC07FM1
Length(NT) : 709
Member of Contig: SY0AAB8YC07FM1

BlastX hits against the NCBI non-redundant database:
DefinitionScoreE_valueAccession Number
C6 transcription factor, putative [Aspergillus clavatus NRRL 1]1531e-08 ref|XP_001268587.1|

Sequence:

>SY0AAB8YC07FM1
ATTGGCACAGCCGGCACCAATGGCCCCGAATTCACATCTTTCGCCCGGGG
GAAGCCAGAAGACTTAGAGGCTCGGATGAATAGACTTGCCGAGATCGTCG
ATAGGTGGTACAAGGATGCGTATGGTCAAAGGATCATACCGCCTGTGGCG
AGACAGCAGGCTGTCGATGCTGTCGGAGTTAACAACTCTGATGCGAAGAG
CTCATTTGAGGGAACTTTGGGACAAATTCCGACACGTGAACGCCTCGTTC
CCCAGGAACAGGGTGTCTCGGACAACATGAGAAAACTCACCTACTCGATC
AGCGGTATCAGCTGTGCCCCAGCCCATTCAATTCCCTGTTCCTCCGTATC
CTCATCCCATTCACCACGTTCGCGGGACACTATCACAACACCTTCTAGTA
GTGCCGACGGGTATTCCCAGCAAGTTTGCACCCTTGAAGGTAAAAATGGA
GCTACACATCCTCCCAAGCAAATGGCGAGGGGACAGCTTGCTATGAAGTT
ACTAGACGAAGAAATTGAAGCAGCAAGAGGGAAAGGCACATGTGACGATA
TAGGTGATCTAGGATTAGGCCATTTGAGTATCCAGGGTCGTGGAAGGAGT
CGATATGTTGGAAGCAGTTTTTGGGCCTCCATAAGCCATGAGATCGCCGA
GCTTAATGACGTCTTACGTGCCAACGAACCGCCCGATACGAGATGCTCTG
CTGGTCCTC

NCBI BlastX