?> MycorWeb

Tuber melanosporum DB

You are here: Genome resources Tuber melanosporum DB EST & Gene Sequences View EST sequence

Tuber melanosporum EST database

Sequence Name: SY0AAB6YA08FM1
Length(NT) : 650
Member of Contig: SY0AAB6YA08FM1

BlastX hits against the NCBI non-redundant database:
DefinitionScoreE_valueAccession Number
glutathione S-transferase, putative [Neosartorya fischeri NRRL 181]3174e-48 ref|XP_001265610.1|

Sequence:

>SY0AAB6YA08FM1
TTGGCACCAAGATTACAAAAAAAAAGATAAAAATGTCCATCACGCTCTAC
ACAAGCCGTATCTGCCCCTGGGCTCACCGTGCACACATAGCATTGGCAGA
GCTCGGGCTAGACTTCAAAGAGGTCACGATTGATCTGATGAAGCCGAGGG
AGCCATGGTACCTTGAGATCAACCCCAGGGGGCTAGTCCCGTCGCTCAAA
TACAATGACGAAATAATCACCGAATCCTCTATTGTCGCTACTTTCCTCGC
GGAATTGAAAGAGAACCACTTAGTCCCCTTCCCGGGCACTCCGGAGGCGG
GCCAAAATCAACTTCTTCGTGGACACCTACTTTACCAAAGCTCAACCGCT
AATCCAATCCGCCCTCGTCACAACCGACATGGCGGCAAAGGCCCGGTACG
CAAACGAGTGCGTCGACGTTATCGAGAAGCAATTGGCGCCGTTGCTGGCG
GACGCTAAGCCCTTCTTTGGCGGGAGCTCCAGGCTCACGCTTGCGGAGGT
GCTTACTGCTTCGTTCGTCGTTAGATTGTATACATACGCGAAGCCTGGGG
TTGACTTTTTCCCCCAGGAGGCGATAGAGATGATCAGGAAGATTGGGAAT
TGGCAAAAGTGGGCGGACGCCTTGCTCGCTCATGAGAGTGTTATGGCGAT

NCBI BlastX