?> MycorWeb

Tuber melanosporum DB

You are here: Genome resources Tuber melanosporum DB EST & Gene Sequences View EST sequence

Tuber melanosporum EST database

Sequence Name: SY0AAB61YP20FM1
Length(NT) : 581
Member of Contig: SY0AAB61YP20FM1

BlastX hits against the NCBI non-redundant database:
DefinitionScoreE_valueAccession Number
FF domain protein [Aspergillus clavatus NRRL 1]4352e-41 ref|XP_001268074.1|

Sequence:

>SY0AAB61YP20FM1
TTGGAGAATATGCTCAAAAAAGGGTGAAGACTTCAGAACAGGGGCCAGTG
GAGTTTACGGAGGACGATGTGGCCTGGCAATTAGAGGCTATAGCTCAGGA
ATATGGCTTTGATGAGGAGGACCTTGATGAAGGCGAGGAAATGACCGACG
AGGACAACATTTATTTGTTCAAGGAGATGTTGGCCGAATACAAGGTCAAC
CCGTACAGCACTTGGGAGAAAGAAATGCCCCGAATCGTGGAAGACTCTCG
CTACGTCCTAATAAACACAACAAGGGCACGAAAAGGGGTCTTCATAAACT
GGTGCCGAGAGCGTATCGCAGAACTAAAGATCGAGAAGGAGAAGACTAAG
AAGCAGGACCCCAGAATACCCTTCTGGGAATTCCTAAAAGGAAATGCAAG
TGCCAAGTTGTACTGGCCCGAATTCAAGAGAAAATGGAAGAAGTCATCAG
AGATGAAAGCCAGCAAAGTGCCTGACAAAGACAAGGAAAAAATGTATAGA
GAATACATCTCTCATATGAAAATTTCCGAACCCCTCCGTGAAAACGATCT
CAAAAAGCTACTAAGGTCCACCACCACCTTG

NCBI BlastX