?> MycorWeb

Tuber melanosporum DB

You are here: Genome resources Tuber melanosporum DB EST & Gene Sequences View EST sequence

Tuber melanosporum EST database

Sequence Name: SY0AAB60YK09FM1
Length(NT) : 587
Member of Contig: SY0AAB60YK09FM1

BlastX hits against the NCBI non-redundant database:
DefinitionScoreE_valueAccession Number
hypothetical protein SNOG_05959 [Phaeosphaeria nodorum SN15]3294e-33 ref|XP_001796348.1|

Sequence:

>SY0AAB60YK09FM1
TTGGGGTTTCATAATCCTCCCCTACAGTTACGGCTAGGCAAATGTCGGTA
CTCAGGCCCGTTGGTCGGTCGCTTCTGGGCCGCCAGATCCTCTCGACACC
TGTGCGCCCTACAGTTCCAGCATTGCTACTAAATAATAGGTCACTTTTCA
CCCCCACTCCGGGGCAGAAGCGATCCAGCTTCAAGTCATTTGTTGCGAGG
TGGGCTGTGGCGGGTGGTTTGATTTACGCTCCCCCAGGATGAGCTGAAGA
CTATACCCCCCGAAGACCAGGACCGCCCAAAGTCATTGCTACCCGAGAAG
GGAGGGAAGTTGGGAAGGCGGCAGAGGTCGGACGCTGAGGATGATGGGCT
CTTGACCGCGGATGAGGCCCGAGGAGGACCGGAGGATTTGGAGGCTGAGG
CGGGACAAGAGGGGGCCTTTGATCCGGAGACTGGAGAGATTAATTGGGAT
TGCCCTTGTCTTGGTGGAATGGCTCATGGTCCTTGTGGGGAAGAGTTCAA
AACTGCTTTTAGTTGCTTCGTTTTTTCGAAGGAAGATCCTAAAGGCGTGG
ATTGTATTGAAAGGTTTAGGGATATGCAAACTTGCTT

NCBI BlastX