?> MycorWeb

Tuber melanosporum DB

You are here: Genome resources Tuber melanosporum DB EST & Gene Sequences View EST sequence

Tuber melanosporum EST database

Sequence Name: SY0AAB59YN04FM1
Length(NT) : 589
Member of Contig: SY0AAB59YN04FM1

BlastX hits against the NCBI non-redundant database:
DefinitionScoreE_valueAccession Number
hypothetical protein MGG_13816 [Magnaporthe grisea 70-15]1592e-09 ref|XP_001404311.1|

Sequence:

>SY0AAB59YN04FM1
TTGGAGCGACGAACCTAGATACTATATCAGATACCCACTGATGATTTAAT
CCCCATATCACGGATCCTATCTTCCCACTTTTGATACCGGTATTTGCGGT
GTGGATAGCGCTAGGGAACGCGTACTGTACAATCCGCCCCACCTTCCGTC
ATTTACCCAACCACAGCTGCACTTTCCACCCTCGATTCCAAACCCAAATG
GCACCCTCAGGAATCTGCATATCCTGCCACGAGGCGCTCACAATCCCAGA
CGAAGACCACCCTCTGGAACCCGGCCTCGTCGGCGACGTAGAATTACGCT
GCGGGCATCATTATCACTGGTCCTGCTTCGCAGAGGAATACTCCGCCGAT
GGCGCCACCCCCGCGACCAAAGCGCAGTGCCCAACTTGCACGCATGACAT
AACCACGAATGGAAAACTCCTAGTCACGCTACGGAACGAAGGTGGCGAGC
AGCCAGACACCGATATCGGAACGCTGCTCGAGGAAGAAGAGTTTTATGGT
CGGAATCCGGAGATGAAGGAGGTTAGGGCTTTTCTCGAGTTTTGCGCTGA
AGGTGACGAGGGTGAGGTTCGGGAAATGCTCGCGGCGAC

NCBI BlastX