?> MycorWeb

Tuber melanosporum DB

You are here: Genome resources Tuber melanosporum DB EST & Gene Sequences View EST sequence

Tuber melanosporum EST database

Sequence Name: SY0AAB59YH09FM1
Length(NT) : 523
Member of Contig: SY0AAB59YH09FM1

BlastX hits against the NCBI non-redundant database:
DefinitionScoreE_valueAccession Number
conserved hypothetical protein [Aspergillus terreus NIH2624]3346e-30 ref|XP_001212453.1|

Sequence:

>SY0AAB59YH09FM1
TTGGAGATGTTAGCCACGATACGCCAGACAATGATGGCCGAACACCGTTC
TTGTGGGCTGTGCGGTGCGGGCGTCATAGAGTAGTAAAGCTACTATTGGA
AAGAGAAGATGTTAGACCCGATATGCCAGACAAAGATGGCCGAACACCAC
TCTTCTGGGCTGCACGGTACGGGCGCGAAGGAGTAGTGAAGCTACTATTG
GAACGAGAAGATGTTAGACCCGATATGCCAGACAAAGATGGCCGAACACC
GCTCTTCTGGGCTGCACGGTACGGGCGTGATGGAGTAGTGAAACTGCTGT
TGGAGCGGGAAGATGTCAACCCCGATATCTCAAACCACGGTGACCAATCT
CCGCTCTCTAGCTGCCGAGTATGGGCTTGATGGAGTAGTGAAGCTGCTGT
TGGAATGGGGGGGTGTCAGCCTAGAGATCCAGACAATGATGGCCGAACAC
CGCTCTTGTATGCTAGGCAGAATGGGCTCGATGGAGTAGTGAAGCTACTG
TTGGAATGGGGGGGGGTGTCAGC

NCBI BlastX