?> MycorWeb

Tuber melanosporum DB

You are here: Genome resources Tuber melanosporum DB EST & Gene Sequences View EST sequence

Tuber melanosporum EST database

Sequence Name: SY0AAB57YF13FM1
Length(NT) : 399
Member of Contig: SY0AAB57YF13FM1

BlastX hits against the NCBI non-redundant database:
DefinitionScoreE_valueAccession Number
hypothetical protein SS1G_09584 [Sclerotinia sclerotiorum 1980]4601e-44 ref|XP_001589862.1|

Sequence:

>SY0AAB57YF13FM1
TTGGGGGGACAACTTTGTACAAAAAAGTTGGGGGGACAACTTTGTACAAA
AAAGTTGGGAAACTATTCTCGACGCTGATCCCGGGGTCCTGGTTCCCGTT
AATGATCTTCCTGACGAAACTATTGAGGGGCAACATGGTCTAATAAAGCA
CTTTTTACTAAATGATAGAAGGAGGGTCTTAACCTTAGACACGGCGGGTG
AGGTGATGATGTGGGATCTACTAAAATGCATGCCAGTCAAATCCTTTGGC
AAAAGGCATCTCGAAGACGTTGCGGCCGAGGTAAACACTGTTGAGAGCGT
GGCGAACTGGTGCCAAATAGATACTCGAACAGGCCGACTAGCCTGTGTCT
TGGAAGAGAATTACTGTTTCGATGCTGAGATGTACGCCGATGAGGCCGA

NCBI BlastX