?> MycorWeb

Tuber melanosporum DB

You are here: Genome resources Tuber melanosporum DB EST & Gene Sequences View EST sequence

Tuber melanosporum EST database

Sequence Name: SY0AAB57YA19FM1
Length(NT) : 554
Member of Contig: SY0AAB57YA19FM1

BlastX hits against the NCBI non-redundant database:
DefinitionScoreE_valueAccession Number
conserved hypothetical protein [Aspergillus terreus NIH2624]3875e-36 ref|XP_001210207.1|

Sequence:

>SY0AAB57YA19FM1
TTGGCATAGCGACATGCGAATACAGCAAGAAGGGATTTGCAAGGAAATAC
GATTGTCAACGCCATACATTGACCCACTACAAAGGCACCATGGTCTGTGG
CTTTTGCCCGGGCAGTGGATCAGCAGCAGAGAAGTCCTTCAACAGAGCCG
ACGTATTCAAGCGCCATTTGATGTCGGTCCACAATGTAGAGCAGACCCCA
CCCAACTCTCGTAAGCGTCCTCCAACAAAGACATCAAACCCCGCAGACCC
CACCTCCTCTGATAGTGAAGACGAGGATGAGGATGAGAAAGACACAACCT
TCAATCCGGCAACCAACAAATCAGCCGCCAAGATCCGCATAAAAAAGGGA
ACTATCAAGCACTCCGGCTCCGGCGCCGGGAGCACGCAGAGGTGACAATC
AGCCCACTCCCGCCCACGAGCCGGGAGTGCCAAAACAAAGACCATTCGCC
GCAAGCGCAAGAATTTTCCGGCAGGGTGGGGATGTCAGCCTGAGCAGATG
GTCACGAAGAGACGCTGCCTGATGGTATTCGATGGACCAAAGTTACTCTG
CAGA

NCBI BlastX