?> MycorWeb

Tuber melanosporum DB

You are here: Genome resources Tuber melanosporum DB EST & Gene Sequences View EST sequence

Tuber melanosporum EST database

Sequence Name: SY0AAB56YJ04FM1
Length(NT) : 491
Member of Contig: SY0AAB56YJ04FM1

BlastX hits against the NCBI non-redundant database:
DefinitionScoreE_valueAccession Number
hypothetical protein SS1G_04226 [Sclerotinia sclerotiorum 1980]2082e-15 ref|XP_001594419.1|

Sequence:

>SY0AAB56YJ04FM1
TTGGGTCGCTACTTGTCAATGGATAAATACCGAGCATGAAGAGGTCACGG
ACGGTTCGGGAGAGCAGAAAATCGGCATAGAAGCCTTTATGCCGAAGCCC
GGTTCAGATCCCGCAATCATATGTAGGAAGCCGCAATGTACGAATTTTGT
TTTTGTGGACAGTCGGCCGGTATCGTGCGCTCGGGGCACTCTGAAGCAAA
TCTTGTCGTTGTATAAATCTTACCTTAAGTCTGCATTACCCGATTCTGCC
ATATCTGATCCTTTCCTCTATCTTAACCTGCGTTGTCCTCCTGGGGCCTA
CGATCCGAATATTGAGCCGGCCAAGGACGACGTCATGTTCTTTCACGCGG
ACCGGGTTATCGGAGCTGTAGAGGTGATTTTCAAGGGCTTATATGGAGAA
CTAAAGACTAAGAGCAGTCCTGGTGGATCTGGAGGGAAGGGGAAGAGCGT
AGAAATGATGACAGGTGGTTTTGAGCTTTTGCTTGCTAGGA

NCBI BlastX