?> MycorWeb

Tuber melanosporum DB

You are here: Genome resources Tuber melanosporum DB EST & Gene Sequences View EST sequence

Tuber melanosporum EST database

Sequence Name: SY0AAB54YE07FM1
Length(NT) : 555
Member of Contig: SY0AAB54YE07FM1

BlastX hits against the NCBI non-redundant database:
DefinitionScoreE_valueAccession Number
hypothetical protein BC1G_02006 [Botryotinia fuckeliana B05.10]1084e-10 ref|XP_001559342.1|

Sequence:

>SY0AAB54YE07FM1
TTGGGCTTAAATTTTTTCACACGCGAGCTTGCTTCCCACTTTCCTCACCC
ACGAACAATTGTTCTGAAACGGCATGTATGGACGGAGAACACATTTCGGA
TTTGGTCCACCAGCTTAACGATGTTGAGCTTGCGGTGCTGTTATCACTGG
TCGCTGGAAAGCACTGTATTCTGACGACAGAGCCAGAATGGCTTGGAGCT
TTTGCGGCAGCAGATTGAGCTAGTGAGTGTTTATCTGAAGTCTTGGGGTT
TTTCTGATGTTTCGGCAGCTCGGGCCAGCCGTATTTGGACTTACGGTGGC
GACCGTTCAGTGCACTCCTGATACCACTCTTGACGATTTTATAGAACCGT
TGCTATTCGACGAAACCCGACCTTCACCCTCCTCACATGGCATATCGCCT
GTGAATAACCGTGAGTCTGGAGAATCCTACTTTGGCACACGAAACCGCTC
AAGCCTTTTACGGACCTCCTCACAGGGTACTCACCACGAGAGCACAAGTG
GTATCCGTAAGCTTGCCAACATTATTATTGCACAGGACCTCGATCTTGCA
AGCAA

NCBI BlastX