?> MycorWeb

Tuber melanosporum DB

You are here: Genome resources Tuber melanosporum DB EST & Gene Sequences View EST sequence

Tuber melanosporum EST database

Sequence Name: SY0AAB53YN07FM1
Length(NT) : 644
Member of Contig: Contig1330


Sequence:

>SY0AAB53YN07FM1
AATTGATACAGCACTACTTCGACAGGATATTCACCACACTTCCGTGTCTG
AACGAGGCTAGTTTCTTCGGCGCTGTGGACTCGGTGTATCGCGATGAATC
GACGTGCTCTCCCTACGATATTTACACGGTTTACATGGTGCTTGCTATCG
GGACGATGTCACTGTCAAAAAGCAGGGACTCCCCGGCAGCACATAATGCG
GCGTGCTTTGTAAAATCTGCGCTTGAGCATGCGGATGCCGTGATTTCTCC
TAGTGCTATCACCGGTGTTCAGGCTGCCCTGCTCCTGGTGCAGTACTCTA
TGCTAGAACCTGCGCATTTTAATAGTTGGTATTTGATTGGGATTGCATCA
CGGATAATGGTGGATTTGGGGCTTCATCAGGAGCCAACAAAAAGCCTGAG
GAAGAAGTCGGCTGACATGGACTTGAGAAGGAGAATTTTCTATTGTGTGT
ATACTTTGGACAGGTCGATCAGTATGGCTCTGCAACGACCATTTACATTC
TCGGACGACTCAGTATTAGTCGACCTCCCAAAACTTGAGGACCCAAAGGT
AGCAAAGCAGATAATAGTCCGGGGAACATTAACGCCTATGGCTGCCGCGA
TACATCTTTTTCGTCTCCGCAAACTGCAATCAGAGTGGTATCAA

NCBI BlastX