?> MycorWeb

Tuber melanosporum DB

You are here: Genome resources Tuber melanosporum DB EST & Gene Sequences View EST sequence

Tuber melanosporum EST database

Sequence Name: SY0AAB53YH16FM1
Length(NT) : 506
Member of Contig: Contig3801


Sequence:

>SY0AAB53YH16FM1
TTGGGCTGAACGGGAGAGGGAGTCTGGGCGTGAAGGTGGGCTAACAGTGC
TACTATCAAACTTAAACATCATTAAGGATAAGACTACTGCAAAGGAGTTT
AAAGAGGATATACTATCGGTACATCGCGCTGCACTCGAGTCGCCAACCCA
TGCCTTGCAAGATTTGGCCCTGCGCTCCATTCCAACAATCTTGCCAAAGC
TTGACTTTCCGACTCTAAAAAACGACCTATTCCCCGCTGTTGCTAGCGTG
TTCACAAAGACCTCATCCCTCGGGATTAAGATTCGCGGCCTAGAGGCTTT
CAAAGTGCTCTGTTCGCCAGCTGCTGCCGCAACCTCGGACGCACCGGAAT
TAGATAAATATACCATCCAGGAAAAGCTTATTCCATTATTGCGTGGAATC
AAAACCAAGGAACCCGCCGTCAGTATGGCGGCACTGGACGTGTTCAAGGT
CATTGGCAAGACGTGTGATAGGGAGGTTGTCGCCATGGAGATTCTGCCAT
GTCTCT

NCBI BlastX