?> MycorWeb

Tuber melanosporum DB

You are here: Genome resources Tuber melanosporum DB EST & Gene Sequences View EST sequence

Tuber melanosporum EST database

Sequence Name: SY0AAB52YJ11FM1
Length(NT) : 516
Member of Contig: SY0AAB52YJ11FM1

BlastX hits against the NCBI non-redundant database:
DefinitionScoreE_valueAccession Number
hypothetical protein SNOG_01493 [Phaeosphaeria nodorum SN15]1957e-14 ref|XP_001792131.1|

Sequence:

>SY0AAB52YJ11FM1
TTGGCACAGTTTGGTTTTCAATAACCAAGAATTACCTTCTCCAGACATCT
CCAGAGCAACTCAATTTGTTTGTTCCTACCCCTCCACCACCCCCAAGCAC
ATAAGATCAGGATAGGGGAATGTCACTCCCGGAAGCTTACCTCGACGAAG
TCAACGCACTCAACCGCGAGATACTAAAATCCAAACCCACGGACGTTCTC
CAGTTCTGTGCTAACTTCTTCAATCGCCGCCTCGAAGCTCAGCGAGTCGA
ATTCCTGCTATCTGCTTCAAATAACTCTGGGTTTTCCTCTTCAAATACTT
TCGGAGCAATGCCAAGTTCCTCAGCATATGGTGGCGGTGAAAGCCTCTTC
CCTGGCTCCGTAGTGAATCTCGGTGGCCCCCCTTTAGATGGGAATCGCGA
GAGCCCTTTTTCCGGAACAATAAGAGAAGAAGATGAAGACGTTGGACAGA
GCCCAACTACCCCTAGCTTCAGACCGGCCGTTCTCGGAGGTCCTAGTATT
TCGAATCCCAGCCTGG

NCBI BlastX