?> MycorWeb

Tuber melanosporum DB

You are here: Genome resources Tuber melanosporum DB EST & Gene Sequences View EST sequence

Tuber melanosporum EST database

Sequence Name: SY0AAB51YN24FM1
Length(NT) : 521
Member of Contig: SY0AAB51YN24FM1

BlastX hits against the NCBI non-redundant database:
DefinitionScoreE_valueAccession Number
Ankyrin repeat protein [Aspergillus fumigatus A1163]4044e-38 gb|EDP48589.1|

Sequence:

>SY0AAB51YN24FM1
TTGGCAGCTCTTATATGGGCAGCTGTAAGAGGGAACGAGGAGGTGGTAAA
GGTGCTTTTGGATCGAGAAGATGTTAATCCCAACCAGACAGACATCAAAC
ATGGCCGAACGCCACTCACGTGGGCCGCTAGGAGCGGCCATGAGGCGGTA
GTAAAGCTACTTCTGAAACGGGTGGATGTCGATCTCAGCCAGGCAGACAC
CGAATATGGCCGGACGCCACTCTCGTGGGCCGCTGAGAATGGCCATGAGG
GGGTAGTAAAGATGCTTTTAGAACGAGCGGATGTCAATCCTAACCAGGTA
GATATCAGATACGGTCAGGCGCCGCTGTCGTGGGCCGCTAAGAAGGGGCA
TGGGGGGGTGGTAAGGTTGCTTTTAGAGCGAGTGGATGTCAATACCGACC
AGGCGGACAGCAAATATGGTCAGACGCCGCTCTCATTGGCCGCTGAGAAC
GGGCATGAGGCGGTAGTAAAGATGCTTTTAGAACGAGTGGATGTCAATCC
CAACCAGGCAGACACTTTTTG

NCBI BlastX