?> MycorWeb

Tuber melanosporum DB

You are here: Genome resources Tuber melanosporum DB EST & Gene Sequences View EST sequence

Tuber melanosporum EST database

Sequence Name: SY0AAB4YI13FM1
Length(NT) : 601
Member of Contig: SY0AAB4YI13FM1

BlastX hits against the NCBI non-redundant database:
DefinitionScoreE_valueAccession Number
predicted protein [Coccidioides immitis RS]1322e-06 ref|XP_001247957.1|

Sequence:

>SY0AAB4YI13FM1
TTGGCGTGCGCTACATTCGGTATCTGTTTCTCCAAAGCGAATCTCGCATC
CTCATCTTCATTAATTCATAATACCGGTGCCGACGGAAGCGCCATCAGAA
GTCTCCAGCTACGAGTAAAGGTCCCCAGCGAGTTCCCCGGCTCTGGAGAC
TGGGCTCAAGTATCGGTACTGCCACCTCGTCCTGCCAACATCGCATGAGC
TCGCTGAGCTGCTAGGCGTTCCCATCCTCTCGCGGATTGCAACTCTTTTG
GGAATAGCTCATACTACCGAATTGGGCCATCGTTTATTTACCAGTTTTCG
TGGTACTAGTTTAACCAACTCACTTGTGAGCTGCAAACGCAACTTCCTTG
CGTCCAAAGAATGGCTCACCATCCCCTGGACCAAGACCCAAAAGACCCCG
ATGCAGCAACTACAAGACCTGCATTTGGAACTCCCGGGTATTCTCGAAGC
TCGACGCGCACTCCCGCGCTCCGCTCATCCCTCGCTGCTCAGGCGGTGCC
TAGATTTTAAGGCCAAGCTGGAAGCATGGTATGAAAACTTTATATCCACC
CCCAGCGCGCACCACTGGCTAGAGTTCTCCGCCTTAAACATTGACCCCCC
G

NCBI BlastX