?> MycorWeb

Tuber melanosporum DB

You are here: Genome resources Tuber melanosporum DB EST & Gene Sequences View EST sequence

Tuber melanosporum EST database

Sequence Name: SY0AAB4YB07FM1
Length(NT) : 703
Member of Contig: Contig1699


Sequence:

>SY0AAB4YB07FM1
TTGGCTCAATTGATAACCATATCCTCACGGTTGTTTCTGCGGACTTTGTG
CCTATACACCCTTATCAGACAAAGTATTTGAACATCGGTATCGGCCAAAG
ATACAGCGTAATTGTTGAAGCGAACCCCTCTGGCCCAGATGTATCTGTAA
ACAGGGACTACTGGATTCGAACAATCCCTGCAGCGGGTTGTAATAACATC
CAATTCCCCGTCAAGCAAACTGGCATAATTAGATACTTCTCTAACTCCAC
ATACACCCTCCCTGTATCCAGCTTCTGGGTAACACAAAAAGGTCAAACGA
CGGAGCCTGATGACTGCGACGACGAGGACATGAAAAATCTCGTACCCGTC
GTGCCAAAGAGTTTGGTCCCCGGGGATTATGCAAATAACTATTCCTCCGA
TACCTATGAAGTTGGCCTGACAGAGCCGACAATCGAGAATCCCATGCCCC
ATGGGTAACTATAGCCGATGGGATATTGCCACGCTTCCTATGTGGCTCGA
ATGGGGAAACCCAACCATATTGAATCTTGATAAGAATGTTAGCAATATGA
GTCAAGAATTGTCGATTGTCCCCGAGGATTATCAGAATAGGTGGGTTGTT
CTAGTGGTTGTCGGCAATTTGACGCTCCCGTCCGGACATAGCGCTGGAAA
GCAGTCTATCCCTACCAGGCACCCTATCCACGTCAGTCCTATCCCCAAAC
TCT

NCBI BlastX