?> MycorWeb

Tuber melanosporum DB

You are here: Genome resources Tuber melanosporum DB EST & Gene Sequences View EST sequence

Tuber melanosporum EST database

Sequence Name: SY0AAB48YN12FM1
Length(NT) : 556
Member of Contig: Contig1535


Sequence:

>SY0AAB48YN12FM1
TTGGCCTACAGGGCGGACAAAATCCCAAGCACAGGCAATCTTCACGACAA
TGAAATCGCATAGCACCCCACCCCCTCCGCAAGGTAACAAGAAGCGTGCG
AGGGAGGAACCGGGGTACGAGCAAGCGAGTACCCCAACCGCGGGACAAAG
CAGCTCCACCACGATGATGCCCGTGCCCATAACCAAACGAAAGCGCGGCC
GTCCTACTAAGGCCGAGACAGAAGCTAGGAAGGCAGCAGAGGCAAGGGGG
GAAATACTGCCCAAGCCGAAACCTTACATTCCCAAGACTACAAGCAACGT
GATCGTCGGGCCGGACGGTCAGATTAGGAGGAGGAGGGGAAGGCCCACGA
AAGCCGAAACTGAAGCTAAGAAGGCGCGGGAAAGGGACTTAAAGAAGAAG
CAGGGCGGCGGAGATGATGATGAGGATGATGACAAGGTGAGGCAGCAATT
GGGACAGAGCGAGCAGAGCGAATTGGCCGACGACGATGACGACGACGATG
TGGAGGAGGATGAATGATCTCTCCGGAGAAAAACGGGTGAGAAAAGGAAA
AAGAAA

NCBI BlastX