?> MycorWeb

Tuber melanosporum DB

You are here: Genome resources Tuber melanosporum DB EST & Gene Sequences View EST sequence

Tuber melanosporum EST database

Sequence Name: SY0AAB48YB16FM1
Length(NT) : 105
Member of Contig: Contig4341


Sequence:

>SY0AAB48YB16FM1
TTGGCCAACTTTTTTGTACAAAGTTGTCCTCCGGCCGCACAACTTTGTAC
AAGAAAGTAGGGTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT
TTTTT

NCBI BlastX