?> MycorWeb

Tuber melanosporum DB

You are here: Genome resources Tuber melanosporum DB EST & Gene Sequences View EST sequence

Tuber melanosporum EST database

Sequence Name: SY0AAB46YH09FM1
Length(NT) : 516
Member of Contig: SY0AAB46YH09FM1

BlastX hits against the NCBI non-redundant database:
DefinitionScoreE_valueAccession Number
hypothetical protein SS1G_03320 [Sclerotinia sclerotiorum 1980]3472e-31 ref|XP_001595231.1|

Sequence:

>SY0AAB46YH09FM1
TTGGATTCATTACACAAACAATGCCGTCCTCGTGCAAAGACATTCGAGCG
GCACTGGCCCAATGTCTTGAAAATTCTGACTGCGTGATGGTCGATCGCAA
CAAACCAGCTGATTGTCTCCGGTATCCACTGGTCGAAACACTACCAACCC
GATGTCAACGGTTGAAGAAAGGCTACGGTGAATGCAAGCGGGGAATGGTT
GATATGCGAAAACGGTTTCGTGGGAACTACCCTGTTGCTCTTTCTGTGGA
AAATGAAGGGGGAGGCGGATCTCGTCAATTATACGGGGGGGGATCTGCAC
TTAGTGACCCTCCATCTGGCACAAAGGCTGAAGGTAAGGAAGGGGGGAAG
TGAAATTAGAAGGTAGCAGTTAACTTGAGTTGTCGGAGTTTTTGAGTTAC
CGGTAGTATGCATACATCGTACCGTTCTTGCGCGTGTACCGTATACACAT
AGGTGCGGGGCTTAGTTAGGCCACTCACTTTTGTATGAATCGTGGGATTT
GAGACATTCAGATCGG

NCBI BlastX