?> MycorWeb

Tuber melanosporum DB

You are here: Genome resources Tuber melanosporum DB EST & Gene Sequences View EST sequence

Tuber melanosporum EST database

Sequence Name: SY0AAB45YE23FM1
Length(NT) : 469
Member of Contig: Contig1882


Sequence:

>SY0AAB45YE23FM1
TTGGATGGGGGCGTAGGTTGATTCCTGTCGAGAGGAAGGATGCTTTCCGC
TTCGATCTTTGGCCGGTCGAGGAGGATGTGGATAATGAGGTTGGGGACGG
GAGTGGTTGGGTTGGCAGGTTCCGAGGAATGAGTCGGGAGTAGAGTAGAG
TGGAGCTGGTTTTGATACACTGTGATTAGTGGGGGGGTGCATTATTGATG
TTTTATGCTTCATCGTTGAAGTTAGTGTCCGAGGCCGAGTTAGTATATGG
GTCTCTTAGTTGTACTGCGTTCCTTGCGATTTCCCTCTTCTTCTGCTGTT
TAATATTTTACTTTGGGTTGGGATTTTGGCTTTTGATCTTCACCTTTCTC
CCTACTCTTATAGCTCAGCATTATATGGTGTTTTAGTCTTTTTCTTTTCT
TTTCTTTTCTTCTTTCTTTCTTCCTAATCTCGTCTTCATCGCATCTGGGT
TATTTCCCCTCCTTTCTTA

NCBI BlastX