?> MycorWeb

Tuber melanosporum DB

You are here: Genome resources Tuber melanosporum DB EST & Gene Sequences View EST sequence

Tuber melanosporum EST database

Sequence Name: SY0AAB44YH09FM1
Length(NT) : 582
Member of Contig: SY0AAB44YH09FM1

BlastX hits against the NCBI non-redundant database:
DefinitionScoreE_valueAccession Number
hypothetical protein DEHA0F19580g [Debaryomyces hansenii CBS767]2182e-16 ref|XP_461148.1|

Sequence:

>SY0AAB44YH09FM1
TTGGGTCCACATCGCGCACAGAGCCTCCTCACACCTGAATTCCCCGGAGT
TAAGCGAGGAATTAGGCCTTCAGGTGGTGAAGAATTTACTATTCCTGACA
AGGTGCTTTCACGCCGCGGGGGTGGGGGCTATATCCTCCGTCCCCATGAA
TGATCCTGAACTCGACGACGTTGAGGAGGAGCAGCACCAGCAGGAAGAGG
GGAGGATAAGAAGGTCGGCGTTGGAATGGCTTGTGCAGAGAATCTCCGCA
ATCTTGCGTAGCGAACGGAACATCAAAAAGGGCCTCCTAGGGAAGAGATT
TGCCATGCAGTGGATTGCCGCGTTAATCCAACTCCTCCCGAAGGGAGATC
TCGAACCACTGGCGAAGACGCTGGTAAGGCCATTATATAATGTGCTAGAA
GTGGATGGTATGCACCTCATGAAAGACCTCAAACCAACAGCCCAAGAACT
CCAATCTTCCATCGCGGAAAAACTAGGCACAACTTTATTTGCTATCATCT
ATAGTCAAGTTAAGAGCGAAGCGCTCGAGAGGAGGAGGGTTAGGAAGGGG
AAGAGGGCGATTCTGGCTGTTACAGATCCGGA

NCBI BlastX