?> MycorWeb

Tuber melanosporum DB

You are here: Genome resources Tuber melanosporum DB EST & Gene Sequences View EST sequence

Tuber melanosporum EST database

Sequence Name: SY0AAB44YD18FM1
Length(NT) : 617
Member of Contig: SY0AAB44YD18FM1

BlastX hits against the NCBI non-redundant database:
DefinitionScoreE_valueAccession Number
hypothetical protein An02g06840 [Aspergillus niger]1709e-11 ref|XP_001399819.1|

Sequence:

>SY0AAB44YD18FM1
TTGGGTCGTTGTCCTTAGGAGAAAATTAGAGGAGTATTTGGAGGATGGTA
GAACGAGAGAGACTTTAGTCGCAGCAGTACAGGAACATGTTATCCAAGCT
TATGAGTCGTACTATGAAGAGATATTTCTTAGGGACGATAGTGTTCCACC
TAGATCTCCCGGAGGTACGGTTTGGGACGTTGAAGTGTTCGTGGGATGGA
GTAACGATATCTTTGCGGTTGGGCATGGCTTTTTGGCATACGATGGCGAT
GGTGCCGGGAGTGAGGATATGAGCCCGGGAATGTCAAGAGCAGGAAGTTT
GTGTACGTAATTGCGGATAGTGCAGATGGGATGCCAAGTCAGAGTGTATC
TCACTAATTCTCGAGGGGTCAGTGGTTGGTTGTTTGGAGGTTGGGATACC
TGATATTGTTAAGTTTGTCCGAGTGATGGATGTTAGAGGTATGGAAGATT
GACGGGTATTTTGACACTCCCCAGTGGTAACTATTTCCCTGGAGCTACAC
TGCCCCGATTCATCTGCCGAGGAATCTCGTTGAATGGTTGCAAGATGCTT
GGGGTATCATATCGGTAGTTCTCCATCACCAGATGCTTATCTAATCCACC
AAAACTCACGTCAATTA

NCBI BlastX