?> MycorWeb

Tuber melanosporum DB

You are here: Genome resources Tuber melanosporum DB EST & Gene Sequences View EST sequence

Tuber melanosporum EST database

Sequence Name: SY0AAB44YB05FM1
Length(NT) : 607
Member of Contig: SY0AAB44YB05FM1

BlastX hits against the NCBI non-redundant database:
DefinitionScoreE_valueAccession Number
hypothetical protein An07g09920 [Aspergillus niger]9262e-98 ref|XP_001392067.1|

Sequence:

>SY0AAB44YB05FM1
TTGGCTTTCCTCCATGCCAATACCAAGTCTTTGCTCGACTCAACCCATGA
GGATGGCAAATATATCAGTGCAAAGGGCAAGGATGTCATCGTTATCGGTG
GAGGTGATACCGGTAACGACTGTATTGGTACCGCTGTTCGTCACGGTGCA
AAGTCAGTTGTCAACTTCGAGTTACTTCCTCAACCACCGAACGAGAGAGC
CAGGGACAACCCTTGGCCGCAATGGCCTAAGGTGTACAGAATTGACTATG
GCCACTCAGAGGTTAAGGCACGATATGGAAAGGATCCTAGAGAATACTGT
GTCATGAGCAAGGAGTTTGTAAGTGATGGCGGCGGCAAGGTCAAGGGTAT
CAACACAGTCCGTGTGGAGTGGGCCAGGAGCTCTCGCGGGGGTTGGGACA
TGAAGCAAGTCGAAGGATCCGAACAGTTCTTCCCTGCAGATCTTGTGCTC
CTCTCAATGGGTTTCTTGGGCCCGGAGGACAGAGTATTGGGTGATATCGA
GAGAGACGCTCGGAAGAATGTCAAGACACCCCCGGGAGCCTACTCTACTT
CCATGCCTGGTGTCTTTGCCGCTGGTGATTGCCGAAGAGGACAAAGCTTA
ATTGTCT

NCBI BlastX