?> MycorWeb

Tuber melanosporum DB

You are here: Genome resources Tuber melanosporum DB EST & Gene Sequences View EST sequence

Tuber melanosporum EST database

Sequence Name: SY0AAB43YG04FM1
Length(NT) : 518
Member of Contig: SY0AAB43YG04FM1

BlastX hits against the NCBI non-redundant database:
DefinitionScoreE_valueAccession Number
unnamed protein product [Aspergillus oryzae]3212e-28 dbj|BAE64082.1|

Sequence:

>SY0AAB43YG04FM1
TTGGCACCTTCCCATCCTCTAACTCCCCTATTGTCCACTACCGGGGCAAA
AAAAAAAAAAAAAAAAAAAAGCGGATACCAACTCTAGCACAACCCTTTAT
TTCCCCTCCCGTTATACTTCCAAACCATTGCAAATTGAAAGATATTGAAA
ATGACGCAGAAGTGTGCCCACAAAGGCTGTGGAAAGACATTCACGGATCC
GGAGGAAGAATGCCACTACCACCCAGGAGCGCCCATATTCCATGAAGGCC
AGAAAGGCTGGCAGTGCTGCAAAACAAGAGTTCTCACCTTCGACGAGTTC
CTCACAATCCCGCCATGTTCAGTCGGCAAGCACTCCGTCGACGCACCTAT
CTTAGCACCCGTACAAACATCCGGACCCGGATCACAACAGCAAAAACACC
CCGAAGTCGCGCCTCCACCGGAGATTGGCTCGGACGGAACAGAAGTATAC
GGCCAACCACAGCCATTGCAGAGGAAGGCGCTCCCGAAAGTGGGTGCAGC
ATCGGGCACTCCTCCGCC

NCBI BlastX