?> MycorWeb

Tuber melanosporum DB

You are here: Genome resources Tuber melanosporum DB EST & Gene Sequences View EST sequence

Tuber melanosporum EST database

Sequence Name: SY0AAB42YF07FM1
Length(NT) : 569
Member of Contig: SY0AAB42YF07FM1

BlastX hits against the NCBI non-redundant database:
DefinitionScoreE_valueAccession Number
predicted protein [Aspergillus terreus NIH2624]2585e-21 ref|XP_001213559.1|

Sequence:

>SY0AAB42YF07FM1
TTGGAAGATATACAAATTCTGCGCTGGCTCTCTCCCCTGGAGCCAAACAA
CAGACACGAAGGAGTTCGTGCCGAGCGATTTGCAGGTGTCGGCGATTGGC
TGTTGGAAACACGCGAGTTTCGGGTATGGAGAGGTTGTGAGGGTGGAGTC
GATAAACCTGTCTTGTTCTGCAGCGGGAATCCGGGAGTGGGAAAGACGTA
CATAAGCTCCCTTGTTATCGACAGCCTGTGCGATCAGGCAGGGAAGGAGA
ATATCGCCGTCGCAGGCCTGTACTGCGACTTCCTAGCTCAGCAGGAACAG
ACAATTACCAACGTGATGGGAGCTATCTTCAAGCAACTCGTCGCCAGAGG
GGACATGCCGAATGATCTGCGGGAGGCATTTGAGAAAGCGAAAAAGGGGT
TTGGTGGCAGAAGGCTGCTACTTCCGGATCTGGTGAAAATGCTGAGGACT
GCGATCGCTTCGCTACCCATAGTATTCATCTGTATTGATGCGCTAGACGA
ATTCTCACCGAAGCATCTCCCGGAACTTCTAAAGTTGTTGGGAGATATTG
TTCGGGAGTCCCCTACTAC

NCBI BlastX