?> MycorWeb

Tuber melanosporum DB

You are here: Genome resources Tuber melanosporum DB EST & Gene Sequences View EST sequence

Tuber melanosporum EST database

Sequence Name: SY0AAB41YJ04FM1
Length(NT) : 622
Member of Contig: SY0AAB41YJ04FM1

BlastX hits against the NCBI non-redundant database:
DefinitionScoreE_valueAccession Number
hypothetical protein FG09586.1 [Gibberella zeae PH-1]1972e-25 ref|XP_389762.1|

Sequence:

>SY0AAB41YJ04FM1
TTGGCTTCAAACTACTGAGACAATCATGAAGCTTTCTATCTTCGGTCTCA
CTGATTGCGGTGACAGTATCATCGGAAAGCCTGTTCCACAAGCTCGCTAA
GCACTTGGTGCCGCCTACGACTGGGTTGAATGAGATTCCGGGAGACAACC
CTCTAAAATACTGCCATGAGGACCATTCCGGTGATATCTTTACTATCGAG
AAGGTCGACCTGACCCCCAATCCGCCCATCCGTGGGAAACCTCTTACTAC
GCAAGCTGTTGGCGTTCTCAAAGACAAGGTTTCCCGAATAGCACCCATGT
CGACGTTACCGTTAAATATGGCCTCATTACGTTGATGAAGCAGTCACTGA
ACATCTGCGACCATGTGGGTGAGCTTGGCCTCGAATGCCCGATTGATCGA
GGCAGGGTGACGCTGACCCAAGTGGTCGATGTCCCCAAATTTATTCCTCC
CGGAAAGTACACTCTCAAATGCAACGTAACGATCGCCGGTGTCAGGCCCA
TAACGTGCCTCACTGGAACTATCGCATTTGGCGGCTGAATATCCACCTCG
CTTATTTCATGATCAGAAATAATACAATATATCCTTGGTTGCCATGCAGT
CGGTGGGGGGGGACGGTTAGAC

NCBI BlastX