?> MycorWeb

Tuber melanosporum DB

You are here: Genome resources Tuber melanosporum DB EST & Gene Sequences View EST sequence

Tuber melanosporum EST database

Sequence Name: SY0AAB41YA11FM1
Length(NT) : 654
Member of Contig: SY0AAB41YA11FM1

BlastX hits against the NCBI non-redundant database:
DefinitionScoreE_valueAccession Number
unnamed protein product [Aspergillus oryzae]3017e-26 dbj|BAE61872.1|

Sequence:

>SY0AAB41YA11FM1
TTGGCCAACTTTTTTGTACAAAGTTGTCCCCCCTGGAGGTTTGGAACGAT
ACCCAGTCAGTTCAACCTCGTTAGCATAATCATCACGCCCGAGGCGCGCT
CAGGGTTTGTGTCATCGCGTTTGCTGAGGAAGGGGTCTGGAGATAGGACA
TTTTATAGGGTTCAGATGGTGTGCAAGGAAGGGTTTTCGGAAATTAGTCC
CGCTCAGGAGCCTAAAATCGTCTCGGAATCATCACTCCCGGCGTTCGTTC
GTAATCTCGCACTCAACGCAAGTGTCTATTCATACGTCTACAATGAAGGC
GGCGGAGAACATATCTCCAACTGGAGGCATCGTCTAAGGAGCATCGCCAA
ATTGAGAGAACGGACCTCCGCCGCGTCCCCGGGATTGGGCGGAAACGGTG
GACCAATCGGCAGCGGTGGCGGCGGAACAACGAGCCCCGGGCAGAACTCG
ACTGCTCCAGGGTCAAGGCGTGTTTCGACGATGAGTGCACAGACTTCGGT
GTCGGATCATAGCTATAGAAATTCGGCCCATATGAATGGTGACACAGATC
AATCTGAAACAGAGGATCTGTTAATGAGCCTTGACTTTAGCAGATTCACT
TAGCGCAACCCCAGCTCCTTGTTCTGCTCCATTCTCATTCTCCATTCCCT
CTCT

NCBI BlastX