?> MycorWeb

Tuber melanosporum DB

You are here: Genome resources Tuber melanosporum DB EST & Gene Sequences View EST sequence

Tuber melanosporum EST database

Sequence Name: SY0AAB41YA10FM1
Length(NT) : 614
Member of Contig: SY0AAB41YA10FM1

BlastX hits against the NCBI non-redundant database:
DefinitionScoreE_valueAccession Number
hypothetical protein BC1G_12282 [Botryotinia fuckeliana B05.10]4299e-41 ref|XP_001549296.1|

Sequence:

>SY0AAB41YA10FM1
TTGGGATTATGAGGATGGTTGTGATGGCGAGGAGGCTACTGGGCTTGAGC
AGAACGAGTTGGAATTAGCCAAAACAGCTGGCACTCCAGCGTTTTTTGCA
CCCGAGCTTTGTCATGTCGATCACAACCAGCCACGACCTCAAATCACTAG
TGCAATTGATGTCTGGGCTCTCGGTGTCACGCTTTACTGCCTTGTCTTCG
CTCGCTGCCCCTTCATGGCAGACAACGAATACCAGCTTCTTAGAGTCATT
GCGAAGGACGAGCTCGTGATTCCTAACCGTCGAGTTCGCCCCGTCAAAGC
CGTCAATTCTTCTAGGCCGGTTAGTGCTCCCCCGACGGCTGAAGAGCTGC
TCGAAATGGAGACGGAGCCGATTGACGTTGATCTCAAAGACTTGCTCAAA
CGGCTCCTTACAAAAGACCCAACCAGAAGGATAACTTTGAGAGAGGTTAA
GCGACATCCGTGGGTTCTCCACGGCATCGCTGATCCTTGTGCCTGGGTTG
ACGAAACGGATCCGGAGAGAATGTCTGACGGCAACAGGATCGAGGTTACC
GTGGAAGACGTGGAGAAGGCTGTTTCTAGTGCTGGTGTGTTGAACCGGGC
TAGAAGCGCTGTCA

NCBI BlastX