?> MycorWeb

Tuber melanosporum DB

You are here: Genome resources Tuber melanosporum DB EST & Gene Sequences View EST sequence

Tuber melanosporum EST database

Sequence Name: SY0AAB39YC17FM1
Length(NT) : 663
Member of Contig: SY0AAB39YC17FM1

BlastX hits against the NCBI non-redundant database:
DefinitionScoreE_valueAccession Number
hypothetical protein BC1G_06998 [Botryotinia fuckeliana B05.10]2847e-24 ref|XP_001554410.1|

Sequence:

>SY0AAB39YC17FM1
TTGGGTTGCATTCAGGATCACGCGGGATCACAAGTCAGTGAGAGACCCCT
CGGGAAATATTCACGATACGTTTAAAAAGACAATGAAAAATATTTGCGGG
CTTTTCGTGCGGGTTCTTGATTCGAAAATCTACCTCGTTCACCAAACCGC
GAGAGAGTTCCTCATTAAAGGATCTTTGGCTGGCCAGGGAAACTGGCAGT
ATACACTGTGTCCCAAGGATTCTAACTTTGTGATTACTGACATTTGCATT
TCTTACCTTTCACGAGAGGAGTTTGCTGGCAGCCCATTAGCAATAAACGC
TTGGGGCGGGGTTTCGAAAGAGGCGGTTGATGATTATCTTCAGAAATACT
CCTTTCTCGATTACGCAGCCCGACACTGGGCAGATCACTTTCGAGATTCC
TTTCGACATACGGAGGATCGGGGGATGGAGTTATTCAACTTTACGCGAAT
AATTTGTGATGCTGGGCCTGAATGCTGTCGAACATGGTTTCAGGTGTACT
GGTTCAATAACCAGTGGTACGATATATTCCCCAAAGATTTTACTCATTTG
ATGATAGCATCATTGCTTGGGCAGGCAAGAGTAGTTGATCGACTATTGGA
AGAGGAGGGAGATGTTAGTGCTCGATCCGAAATACATGGCACTGCGTTGA
ACATCGCAGCGGT

NCBI BlastX