?> MycorWeb

Tuber melanosporum DB

You are here: Genome resources Tuber melanosporum DB EST & Gene Sequences View EST sequence

Tuber melanosporum EST database

Sequence Name: SY0AAB38YG19FM1
Length(NT) : 597
Member of Contig: SY0AAB38YG19FM1

BlastX hits against the NCBI non-redundant database:
DefinitionScoreE_valueAccession Number
hypothetical protein AN7049.2 [Aspergillus nidulans FGSC A4]5435e-54 ref|XP_664653.1|

Sequence:

>SY0AAB38YG19FM1
TTGGGGTTATTCTACGTGATTTTTTGCCTTACGCTGGTTGCCTGGGTCCA
GTTGGAGCACAAAATCCACCAGCACTCGCACCGAAAGATGCAGGAGTCTC
GGGGATCTCGCAAAGGGGAAACGAAAGATGCACCGGGCGGTGTACCCAAG
AAGGACTCAACGGCTTCCGCAGCCGAACCACTGACCCCGCATTCCCAAAC
ATGGAGGGGACTAACCCTTGCTGATGCAAGGATCGCACTGTTCTTCTTCT
TCTTGATTCAGGTGGCGTTCTTCGGAACTGGCAACGTTGCTTCATTGTCG
TCTTTCTCTCTAGAGAGCGTATATCGCCTTATACCCGTGTTTAATCCCCT
CGCAATGGGGGCGCTTTTGGTTTTAAAGCTGATGGTTCCGTTCGCGGTGA
TCTCAGCGAACCTTGGGATACTGAACAGGAGGATCGGAGTGGCACCAAGC
TCTCTGTTCATGGTGGTCATGGCCATATCAGATGTCCTAACACTCAACTT
CTTCTATATGGTTCGGGACGAAGGGAGCTGGTTGGACATTGGCACGACCA
TCAGCCATTTCTGCATATCGAGCATGTTGGGAGTTTTCGTCTCGGCA

NCBI BlastX