?> MycorWeb

Tuber melanosporum DB

You are here: Genome resources Tuber melanosporum DB EST & Gene Sequences View EST sequence

Tuber melanosporum EST database

Sequence Name: SY0AAB37YC14FM1
Length(NT) : 641
Member of Contig: SY0AAB37YC14FM1

BlastX hits against the NCBI non-redundant database:
DefinitionScoreE_valueAccession Number
predicted protein [Ajellomyces capsulatus NAm1]1369e-07 ref|XP_001543916.1|

Sequence:

>SY0AAB37YC14FM1
TTGGCGACTCGCCGGCAATCTCTGTTCGAAACTCGTCATCTCTCTCGCCC
CTCACTTGCTGATGACATTATACTTGGTCCGCCCAAGATGATGTTCGCAT
CCTCGTCCACTCGAATACCTTCCGGAAAGTTTGACCACGATTCCCACACT
ACTTCTTTAGCCTCGCCAGTTATTGATGAAGATCGTGAAAGCTCCCGTTT
CGAACGGTTTAGAATGGGTGGGGGTATTAGGCTTGGCAAAGAGATGGACA
AAGATCGTCCTGAACGCAGTAGCTTGCGCGGGGACCATACTAAACGAGGC
TTCGGTAGAGACGATGCTGAAGGTTGGACTAGTGTGTCCCGCCAACCTCG
CAAGAGCTTTGGGGCGGAGGACGGTGATCGTTTCCGTGGTGCTGGTGATA
GGGGAAAGAGGGAAAATCCATGGGATAAGGACCGTCCGCCCAAATACGAC
AATTTCGGTAGAGAACGTGAACATCGTCCAAGGGGGAGGAGGGATGAGGC
AAGCTGGTTGCTCGAAGATCGTGGTACCGACAGGGGAGGAGACCGCGACC
ATTACCGTGACCGCGACCACCACCGTTATAACAGCAGTAGCAACAGAAAC
GAGAAGGACCCCGAATGGATGGATTCAGGTCCAGGCAATGA

NCBI BlastX