?> MycorWeb

Tuber melanosporum DB

You are here: Genome resources Tuber melanosporum DB EST & Gene Sequences View EST sequence

Tuber melanosporum EST database

Sequence Name: SY0AAB36YB13FM1
Length(NT) : 631
Member of Contig: SY0AAB36YB13FM1

BlastX hits against the NCBI non-redundant database:
DefinitionScoreE_valueAccession Number
hypothetical protein BC1G_09005 [Botryotinia fuckeliana B05.10]5812e-58 ref|XP_001552823.1|

Sequence:

>SY0AAB36YB13FM1
TTGGATCAGTAACTACAAAAAAGATAAAATCGACGAAAACAGCGAGAAAG
CAAAGCCCAATTCTAAGAAGATGTCTACAGAATACTCTTTCAAGGGATGG
GTTGGTTCGAGCAATGATTGTATCGAGAAGCAGAACCTTGTCTATAAGGA
TATCGAGCCTAAGAGATTCACGGAGGACGATGTGGATATTCGGATCACCC
ATTGTGGTATTTGCGGGACTGACGTCCACACCCTGACGAACGGCTGGGGC
TTCACGAGCTATCCCGTTGTTGTCGGCCACGAAATCGTCGGCACGGCAGT
GAAAGTTGGGAAGAACGTCCAGGGAATCAAAGTCGGTGACCGGGTCGGTG
TAGGTGCACAGGACATGGTAGGAACCTATAATGGCAAGTACCCCGACGGC
AGCATGTCCACTGGTGGATTCGCCGACTACACTCGTGTTCCTGGCCACTT
CGTTTTCAAGATCCCGGAGGCACTCTCTAGTGAAATCGCTGCGCCCATGC
TCTGCGGTGGAATAACCATGTTTTCACCCTTAAAGCGCAATGGCTGCGGA
CCCGGAAAGACTGTTGCAATTATCGGCTTTGGAGGTTTAGGACACTTCGG
CGTCCTCTTCGCAAAAGCCCTCGGTGCGGAC

NCBI BlastX