?> MycorWeb

Tuber melanosporum DB

You are here: Genome resources Tuber melanosporum DB EST & Gene Sequences View EST sequence

Tuber melanosporum EST database

Sequence Name: SY0AAB35YL16FM1
Length(NT) : 468
Member of Contig: Contig1756


Sequence:

>SY0AAB35YL16FM1
TTGGCCTGACGATAGCAAACAAAACATACAAGCAAACAATCTTACCCTGT
CAGTCACTTTGGCCGCCGTCTTACCCTTCTCCGAGCCTCCTTACCCTAAT
GGTCTCCCATCTCCATACTACGCCCCCTTGCATCACCGCTGGCAAAAGGC
TTGTTGCGCGTTCATTAGCGAGAACCTCACCGCGAACGCCTTGGAATGGG
AGCGGGAGGAGTTGGTTCCCCCAGAGATCTTCAGCAAGTTTGCTGCAGCA
AATTTCCTCCTGCCGAGCCTTCCTGCTCCGCTGCTGATCGAGTGGGCTAA
GCAGCTGGGTTTGGACATACTCGCAAGAGGTCTAAAAGTGGAGGAGTTTG
ATTATCTGCACTTTTTAATTTACAGTGATGAGATGACGGGGAACGGGCTG
TCTGGTCCTGGTGCCTCGCTTACGACCGGGATAACATTCGGGGTTCCGCC
GATATTAAAGTTTGGGAG

NCBI BlastX