?> MycorWeb

Tuber melanosporum DB

You are here: Genome resources Tuber melanosporum DB EST & Gene Sequences View EST sequence

Tuber melanosporum EST database

Sequence Name: SY0AAB35YE10FM1
Length(NT) : 557
Member of Contig: SY0AAB35YE10FM1

BlastX hits against the NCBI non-redundant database:
DefinitionScoreE_valueAccession Number
hypothetical protein SNOG_06715 [Phaeosphaeria nodorum SN15]2827e-24 ref|XP_001797078.1|

Sequence:

>SY0AAB35YE10FM1
TTGGCGGGGATGAGATCCGAGGTTCCTCAACAAAAGTGAACATGACCTCC
CAGGACACGACCGACGGCACTCAAGCTGAGAAACTCAAAAAACGCAAAAC
TCCAACAGCCCAGATCAAATATGACGATTGGCATACCCACCGCATGGATT
GGGTACATGGCGAGTCATCCTGGTTCGTGGACGGCGAGCATTTCCTTGAT
AAGAAATATGGTGTTCCAACCGTTGCTTCCAGCTTTATTATGAATTTGTG
GTCTGATGGTGGTGTCTGGTCCGGAAACATGACAAAGGGAAAGTCTGCTT
ATGCGGAGATTGAATTCGTAGAGATGGCGTTCAACACTACCGGGGATGAC
CGCGGCTCCGCGAACAGCAAAGTGAGGAGGGCTACAAGGAATAAGTGTGA
TAGGATCTGTGTGATCGATGATGTGGCTGTCGTTGGAACACCAGAAGGTG
CAAAGGGTGGGGCTTTCAAGAAGGCCGTCAATCCATGGTCTTTGGGTGTG
GCTATGTTGGTCGCCGGCGTATTGTCCTTTTAGGACGAGACTGCGGGTAC
ACCGTTG

NCBI BlastX