?> MycorWeb

Tuber melanosporum DB

You are here: Genome resources Tuber melanosporum DB EST & Gene Sequences View EST sequence

Tuber melanosporum EST database

Sequence Name: SY0AAB33YG09FM1
Length(NT) : 419
Member of Contig: SY0AAB33YG09FM1

BlastX hits against the NCBI non-redundant database:
DefinitionScoreE_valueAccession Number
DNA-directed RNA polymerases N/8 kDa subunit superfamily [Neosartorya fischeri NRRL 181]3328e-30 ref|XP_001262893.1|

Sequence:

>SY0AAB33YG09FM1
TTGGATCCCGATTCGCTGTTTCTCATGTGGTAAGGTTGTCGGTGATCTCT
GGGAGCGGTACCTCAAGCTTCTTGAAGATGGTGTTGCGGAAGGTGATGCT
ATGGACCAACTTGGGTGCAAGCGCTACTGCTGTAGGAGAATGTTGATGAC
TCACGTAGACCTCATTGAGAAGCTCTTGCGATACAACCCACAGGAGCGCA
CCAGGATCGGCCGTGGTTAGATTTTCGCTCCCTCCCGAAATTTTGCTCGA
GCATAGTCCCTTCATTTCTGCTCGCGCTCTCGCATGCCAACTACTACGAT
CATCGCTTGTTAGATGCCCCCTGTCACCCCCCACGCTGCCCGAGGATGGA
AAGGGTTGCAGTAATTAGAGCAGAAGGGCGCAAATGTACATTAGGCGAAA
TTTGAGATTTTCTATTTCG

NCBI BlastX