?> MycorWeb

Tuber melanosporum DB

You are here: Genome resources Tuber melanosporum DB EST & Gene Sequences View EST sequence

Tuber melanosporum EST database

Sequence Name: SY0AAB32YC05FM1
Length(NT) : 545
Member of Contig: SY0AAB32YC05FM1

BlastX hits against the NCBI non-redundant database:
DefinitionScoreE_valueAccession Number
hypothetical protein MGG_01745 [Magnaporthe grisea 70-15]4897e-48 ref|XP_363819.2|

Sequence:

>SY0AAB32YC05FM1
TTGGTGCTTCTGTATGATACTCCCTCGCGTGAAGCACCGAGCTTTTTTTC
CCGGGCATTTAACATCTTTATTATTAATTTACGGTTATTGCTTTTTCTCA
AGCCTAAACCTCCAAAATGTCGAAAATGTGGGAGGTTGACCCCGAGACGA
GGAGAAAGCTCCTTGAGATCCAAAAGAGGGATGGGAATAATGTTTGCTGC
GATTGTAATGCTCCTGCCCCTCAGTGGGCCAGCCCGAAGTTCGGGATTTT
CATCTGTTTGACTTGTGCGGGTGTTCACCGAGGTTTAGGTGTTCATATAT
CTTTCGTGCGCTCAATCACAATGGACTCCTTTAAAAATGAGGAGATCAAA
CGTATGGAGAAGGGAGGGAACAAGAGGTGCCAAGAGTTTTTTCAGAAGGC
GCCCGAGTTTGGTGATAATATGACTATTAGCGAGAGGTACGGAAGCTCTT
TTGGTGAGGACTATAAAGAAAAGTTGACGGCAGACGTCGAGGGTCGGGAG
TGGGTACGGAAAGAGCGCCTTAAAGCGTCTCCTTCTCTTGCTTTG

NCBI BlastX