?> MycorWeb

Tuber melanosporum DB

You are here: Genome resources Tuber melanosporum DB EST & Gene Sequences View EST sequence

Tuber melanosporum EST database

Sequence Name: SY0AAB31YN05FM1
Length(NT) : 375
Member of Contig: SY0AAB31YN05FM1

BlastX hits against the NCBI non-redundant database:
DefinitionScoreE_valueAccession Number
hypothetical protein SS1G_06016 [Sclerotinia sclerotiorum 1980]2979e-26 ref|XP_001593094.1|

Sequence:

>SY0AAB31YN05FM1
TTGGGCATGGGAAGGCTGTTGCGTTATTCGACTTTATTAGAGAGAACGAG
AATGAGCTTCCATTGGTTGAAGGCCAGGTTGTGTGGGTTAGCTATCGGAT
TGGAGTGGGTTGGCTAGTGGCTGAGGATCCGAAGACTGGCGAATCAGGCC
TGGTCCCAGAAGAATATGTCCGTCTCCTCCGCGATCTGCAACCCCTCTAC
ACCCCACATCCGGAATCAGGATCCCCACCCAATCCCCACCATGATCAAGA
ATCCCCGCTAATATTATCCGGCTCTCCCCAACCTTCGTCCCGGTCCCCCT
CTCCCTCCTCCTCCCCACAGCAACCCCCCTCAACCTCTTCAACCTCGACA
ACCTCAGCAACCTCAACCTCAAACA

NCBI BlastX