?> MycorWeb

Tuber melanosporum DB

You are here: Genome resources Tuber melanosporum DB EST & Gene Sequences View EST sequence

Tuber melanosporum EST database

Sequence Name: SY0AAB2YE10FM1
Length(NT) : 660
Member of Contig: SY0AAB2YE10FM1

BlastX hits against the NCBI non-redundant database:
DefinitionScoreE_valueAccession Number
conserved hypothetical protein [Ajellomyces capsulatus NAm1]5642e-56 ref|XP_001543333.1|

Sequence:

>SY0AAB2YE10FM1
TTGGCGGGCTAGATCATCAAGACACCTTACAGAGCGTTAACAATCTCGGT
GCGACTCTAGCTAGTCAAGGGAAATACGATGAGGCAGAGATTATACATAG
ATGTGCATTGGCGGGCAGGGAAAAAACGCTCGGGCTAGATCATCGAGATA
CCTTACAAAGCCTTCATGATCTGGGTGTGGCGCTACATTCTCTGGAAAAG
TACGGCGAGGCCGTAGATATGCATCGACGCGCATTGGCGGGCAGAGAGAA
GGGGCTTGGGCTAGATCATCAAGATACCTTAAAGAGTGTTAATAATCTCG
GCGCGACTCTGCATAGCCAAGGAAATTACAATGATGCCGAGGTTATGCAT
CGACGTGCATTGGCGGAAAGGGAGAAAACCCTAGGGATAGATCATCGAGA
TACCCTGCTGAGTGTCAACAATCTCGGTACGACTCTGCGTAGTCAAGGAA
GGTACGGCGAAGCTGAAATTATGTACCTACGCGCATTGGCGGGCAGAGAG
AAAACGCTCGGGTCAGATCATCGAGATACCTTACAGAGTGTTAAGGATCT
AGGTGTGGCATTGTATCGTCAGGAAAAGTACGATGAAGCGGAGATTATGC
GTCAACGTTCTTTCGCTGGGCTAGAGAAAGCCCTTGAGGTTGACGACCGG
GATTGCCTAG

NCBI BlastX