?> MycorWeb

Tuber melanosporum DB

You are here: Genome resources Tuber melanosporum DB EST & Gene Sequences View EST sequence

Tuber melanosporum EST database

Sequence Name: SY0AAB29YE02FM1
Length(NT) : 667
Member of Contig: Contig4596


Sequence:

>SY0AAB29YE02FM1
TTGGGTGAAATTGATCAATACTCACCAGTCCCTATTATCAGGCAATTACT
TTCTGGTATATCGTGAAGGTAAAGTGAGTTAGCGGGTAGGGCACAGTGCG
TAGTCAAACCACCATCCGGGAAAAGGGAAGGAAAAGAAAACCCCCAAACA
CCGGTATGGTCGCACCTAAACCCGAACTGCGGCGTTCTTTTGATGATCGA
GAGGGGCACTCCAATAGGCTTCGAGGCCATCGCCTAAGCCCGCTCCGCTA
CCCTAAAGGACTACATCAAGGACATTGGCAAAGCTTTTCAATCCTTCTCG
ACCACGATTGCCCACGGCTCCGCCAACACCCCTATCGAACAGGGGCCCAT
CGCTATAATCGCCTCTTGCACGAACCACGAACAATGCACCCTGTTCGTCT
CTCGCCCCATGGACGGCACCCAACGCAAAGAATACCGCCGCTTTTCACAA
TGCTATGAGCGTCTCGGCTATCTACGGAGACTCATGGGGGAGCAATCCAA
AAACTATGAGCACCACGAGCACTCATACGTCATCTCCCGCCGTGGCGTCT
ACCACCGCACCGACATGAACAAGATCAGCCCAACAATAGACGACTTTGGC
ACAACCCCCGTCGACGGTGAACCCGACACGCCAGTTCAAAGCCCAGTGGG
TAGACGGTGTCACAACT

NCBI BlastX