?> MycorWeb

Tuber melanosporum DB

You are here: Genome resources Tuber melanosporum DB EST & Gene Sequences View EST sequence

Tuber melanosporum EST database

Sequence Name: SY0AAB28YO12FM1
Length(NT) : 646
Member of Contig: SY0AAB28YO12FM1

BlastX hits against the NCBI non-redundant database:
DefinitionScoreE_valueAccession Number
hypothetical protein CIMG_03455 [Coccidioides immitis RS]3412e-30 ref|XP_001244014.1|

Sequence:

>SY0AAB28YO12FM1
TTGGGTGGTTCCATGGCGCCAGTCGAAGCTCACTGAGTTGTTATTCTCCA
ATTCATTTTCGGGCGCTGGGGGTGGGGGGCAGAGGGCCAGCATGATAGTC
ACCGCGGACGCCATGGGTGACTTCAACGCTACGACGCAGATACTGCGCTA
CTCCGCGCTGGCCAGAGAAGTGACAGTCCCCCGGGCATCCAGCCGACAGA
TCTCCGGAATGTCCGACTCCAGCGCCGCTTCCTCCACTCTGGACGAACTA
GCAGCAATCCCAACCTCCGTCACCCAAGACGACAGCAAAGACATCCTGAT
AGCGCGCCTAATAGCGCAGTTGGAAGAGACTGAAGCCCGCTGGCGCGACG
CCGAGGAACGCTGCCTATCAACCGAGCAGCAAGTGCGCGAAGAGGTAGCA
GACGAGATGGAAGAGCGCCTGGAAGAAGTCCGCCGGGAGACACTAGAGCA
CTATGAGATGGAAGAGGAGTGGCGGGAAGGCTACGTCGATGGGAAGCTGG
AGATTCTGCGTAAGGGCATCAAAATTCGCGAAGACACACCCCCGGGCGCA
GCCGAGCGGATACGGGAACTCGAGGGTGAGAATGAGGCGCTGAGGAGGGA
GTCGTTAGTGCTTAGACGGGAGGCGCTGGGGAGGAGTCCTTCCAAG

NCBI BlastX