?> MycorWeb

Tuber melanosporum DB

You are here: Genome resources Tuber melanosporum DB EST & Gene Sequences View EST sequence

Tuber melanosporum EST database

Sequence Name: SY0AAB28YN24FM1
Length(NT) : 502
Member of Contig: SY0AAB28YN24FM1

BlastX hits against the NCBI non-redundant database:
DefinitionScoreE_valueAccession Number
Mannosyltransferase of the KTR1 family, involved in protein N-glycosylation; located in the Golgi apparatus; Yur1p [Saccharomyces cerevisiae]1842e-26 ref|NP_012396.1|

Sequence:

>SY0AAB28YN24FM1
TTGGGGCATACGGGTCAGCCTCAACATGGGACAGATACAGCTGAACTGGA
GGATGGCCCCCCGAGCGCAACCTGTTTCGGCGCCGAGCTCGGGCATAATG
GAACCGAGAAGGCGACCCTGGTTATGCTCGTAAGGAATAGTGAGCTCCAC
GGGGCCTTGTCTTCTATCAGGATGGTCGAGGATAGGTTCAATAGACGATT
CCACTATCCGTGGACTTTCCTTAACGACAAGCCATTCACCGACGACGTAA
GTGAAATTCTGACCCGAGGAGGCTCTCGCTCGCTCATCCCGATTGGCCTG
GTTTCTGATATCACGGTAGTTCATCAAGTACACTTCCGGACTCGCCAGTG
GCCCGGTTGAATACGCCGTCATCCCGGAGGATGATTGGTCCATTCCCGAC
CATGTAAACACGACAATTATGAGAGCAGAAATGTTGCGGATGGCAAAACA
GGAGATCATCTATGGCGGTTCCTTATCTTACCGACACATGTGCCGATTTA
AC

NCBI BlastX